Sequence retrieval

Genome: Mycoplasma putrefaciens Mput9231
Start position: 637510
End position: 637533
Length: 24

DNA sequence
>NC_021083, from 637510 to 637533 (24 bp); Mycoplasma putrefaciens Mput9231 TTATTATTTTTATTACTATTATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 636418-637536	Sequence	MPUT9231_5310 pkn Serine/threonine protein kinase (Protein is coded in complementary strand; from 637536 to 636418)