Sequence retrieval

Genome: Mycoplasma putrefaciens Mput9231
Start position: 639895
End position: 639918
Length: 24

DNA sequence
>NC_021083, from 639895 to 639918 (24 bp); Mycoplasma putrefaciens Mput9231 TTTGATTTTGATTTTCATTTTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 639783-641039	Sequence	MPUT9231_5340 rsmB rRNA methyltransferase small subunit B (Sunfamily protein) (Protein is coded in complementary strand; from 641039 to 639783)