Sequence retrieval

Genome: Mycoplasma putrefaciens Mput9231
Start position: 726384
End position: 726407
Length: 24

DNA sequence
>NC_021083, from 726384 to 726407 (24 bp); Mycoplasma putrefaciens Mput9231 AGTTTGAATTTGAGTTTGAGTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 725623-726819	Sequence	MPUT9231_6240 - Hypothetical protein (Protein is coded in complementary strand; from 726819 to 725623)