Sequence retrieval

Genome: Mycoplasma putrefaciens Mput9231
Start position: 754716
End position: 754739
Length: 24

DNA sequence
>NC_021083, from 754716 to 754739 (24 bp); Mycoplasma putrefaciens Mput9231 TTTTCATATTCATTTACATTTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 753906-755339	Sequence	MPUT9231_6470 - Hypothetical protein, predicted lipoprotein (Protein is coded in complementary strand; from 755339 to 753906)