Sequence retrieval

Genome: Mycoplasma putrefaciens Mput9231
Start position: 780669
End position: 780692
Length: 24

DNA sequence
>NC_021083, from 780669 to 780692 (24 bp); Mycoplasma putrefaciens Mput9231 ATTTTTATTATTATTATTATTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 780686-781309	Sequence	MPUT9231_6690 upp Uracil phosphoribosyltransferase (Protein is coded in complementary strand; from 781309 to 780686)