Sequence retrieval

Genome: Mycoplasma putrefaciens Mput9231
Start position: 243573
End position: 243602
Length: 30

DNA sequence
>NC_021083, from 243573 to 243602 (30 bp); Mycoplasma putrefaciens Mput9231 ATCATTTGCTATTATTTACTATCATTTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 243410-244642	Sequence	MPUT9231_1990 - hypothetical protein (Protein is coded in complementary strand; from 244642 to 243410)