Sequence retrieval

Genome: Mycoplasma putrefaciens Mput9231
Start position: 520140
End position: 520175
Length: 36

DNA sequence
>NC_021083, from 520140 to 520175 (36 bp); Mycoplasma putrefaciens Mput9231 GTTGTTGGTTTGGATCTTGGTTTGGATCTTGGTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 520136-521917	Sequence	MPUT9231_4430 dnaK Chaperone protein dnaK (Protein is coded in complementary strand; from 521917 to 520136)