Sequence retrieval

Genome: Mycoplasma putrefaciens Mput9231
Start position: 624155
End position: 624190
Length: 36

DNA sequence
>NC_021083, from 624155 to 624190 (36 bp); Mycoplasma putrefaciens Mput9231 TGGTGATGGATTTGGTTCTGGATTTGGAGATGGAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 622437-624464	Sequence	MPUT9231_5200 - Hypothetical protein, DUF285 family,predicted transmembrane protein (Protein is coded in complementary strand; from 624464 to 622437)