Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. U288
Start position: 1948963
End position: 1948986
Length: 24

DNA sequence
>NC_021151, from 1948963 to 1948986 (24 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. U288 GCTGCGGCTGCCGATGCGGCTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1947433-1949805	Sequence	STU288_09310 - side tail fiber protein (Protein is coded in complementary strand; from 1949805 to 1947433)