Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. U288
Start position: 377016
End position: 377039
Length: 24

DNA sequence
>NC_021151, from 377016 to 377039 (24 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. U288 GGAGCCGGAGCTGGTGCCGGAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 376599-377651	Sequence	STU288_01695 - outer membrane protein A (Protein is coded in complementary strand; from 377651 to 376599)