Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. U288
Start position: 4085781
End position: 4085804
Length: 24

DNA sequence
>NC_021151, from 4085781 to 4085804 (24 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. U288 TGATCATGTTCACGATCATGACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4084491-4086359	Sequence	STU288_19630 trkD potassium transport protein Kup