Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. U288
Start position: 1564932
End position: 1564958
Length: 27

DNA sequence
>NC_021151, from 1564932 to 1564958 (27 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. U288 GCAGCGCCAGCAGCGCCAGCGGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1564832-1565044	Sequence	STU288_07630 - cytochrome c biogenesis protein CcmD (Protein is coded in complementary strand; from 1565044 to 1564832)