Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. U288
Start position: 3468886
End position: 3468912
Length: 27

DNA sequence
>NC_021151, from 3468886 to 3468912 (27 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. U288 TCGCCGCCGTCGCCGCCATCACCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3467845-3469017	Sequence	STU288_16710 obgE GTPase CgtA (Protein is coded in complementary strand; from 3469017 to 3467845)