Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. U288
Start position: 4011315
End position: 4011341
Length: 27

DNA sequence
>NC_021151, from 4011315 to 4011341 (27 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. U288 GCAGCGCCAGCAGCGCCAGCGGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4011215-4011427	Sequence	STU288_19290 - cytochrome c biogenesis protein CcmD (Protein is coded in complementary strand; from 4011427 to 4011215)