Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. U288
Start position: 2176896
End position: 2176925
Length: 30

DNA sequence
>NC_021151, from 2176896 to 2176925 (30 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. U288 TTCGCGCCAGTTCGCGGCATCGCGCGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2176249-2177238	Sequence	STU288_10400 moaA molybdenum cofactor biosynthesis protein A (Protein is coded in complementary strand; from 2177238 to 2176249)