Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. U288
Start position: 4334282
End position: 4334311
Length: 30

DNA sequence
>NC_021151, from 4334282 to 4334311 (30 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. U288 CGCGGTAAATCTCGATAAATGGCGGTAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4333171-4334322	Sequence	STU288_20755 - acetylornithine deacetylase (Protein is coded in complementary strand; from 4334322 to 4333171)