Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. U288
Start position: 451204
End position: 451233
Length: 30

DNA sequence
>NC_021151, from 451204 to 451233 (30 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. U288 ACGAAAAATAACCAGAAATAACAAAAAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 450264-451418	Sequence	STU288_02075 opgC glucans biosynthesis protein (Protein is coded in complementary strand; from 451418 to 450264)