Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. U288
Start position: 197422
End position: 197466
Length: 45

DNA sequence
>NC_021151, from 197422 to 197466 (45 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. U288 GGCGAGATGGATCATGGCAACATGGATCACAGCGGGATGAATCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 196238-197848	Sequence	STU288_00850 - multicopper oxidase