Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 102685
End position: 102709
Length: 25

DNA sequence
>NC_021236, from 102685 to 102709 (25 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 TTTTTTATTTGTTTTTTTCTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 102407-102727	Sequence	SLY_0117 - Hypothetical Protein (Protein is coded in complementary strand; from 102727 to 102407)