Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 114859
End position: 114883
Length: 25

DNA sequence
>NC_021236, from 114859 to 114883 (25 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 ATAAAACAAAAGAAAAAAAAAGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 114224-114901	Sequence	SLY_0138 ygiH Hypothetical UPF0078 membrane protein (Protein is coded in complementary strand; from 114901 to 114224)