Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 197544
End position: 197573
Length: 30

DNA sequence
>NC_021236, from 197544 to 197573 (30 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 ATTTTAGTTAATTTTAAATAATTTTTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 195867-197606	Sequence	SLY_0236 ytmL putative amino-acid ABC transporter permease protein ytmL (Protein is coded in complementary strand; from 197606 to 195867)