Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 244246
End position: 244275
Length: 30

DNA sequence
>NC_021236, from 244246 to 244275 (30 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 TTTTTATTTTCTTTTTCTTTTTGTTATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 244170-244592	Sequence	SLY_0294 ruvX Putative Holliday junction resolvase (Protein is coded in complementary strand; from 244592 to 244170)