Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 253565
End position: 253589
Length: 25

DNA sequence
>NC_021236, from 253565 to 253589 (25 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 AAAAAATAAAAGAAAAAAGAAAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 252734-253636	Sequence	SLY_0304 cdsA Phosphatidate cytidylyltransferase (Protein is coded in complementary strand; from 253636 to 252734)