Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 264138
End position: 264161
Length: 24

DNA sequence
>NC_021236, from 264138 to 264161 (24 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 TTGTTGTAGTTGTAGTTGTTGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 259464-264206	Sequence	SLY_0313 pan Proteasome-activating nucleotidase