Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 305755
End position: 305778
Length: 24

DNA sequence
>NC_021236, from 305755 to 305778 (24 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 AAAAAGAAAAGGAAAAATAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 305779-305916	Sequence	SLY_0352 - Conserved Hypothetical Protein (methylase)