Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 386578
End position: 386607
Length: 30

DNA sequence
>NC_021236, from 386578 to 386607 (30 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 AAAAAACATTAGAAAAAATTAAAAAAGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 386020-386715	Sequence	SLY_0455 - hypothetical protein