Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 413987
End position: 414040
Length: 54

DNA sequence
>NC_021236, from 413987 to 414040 (54 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 ATTTTTAAAATTAAAAAATTTTTGGAAATTAAAAAAATTCTTAACATTCAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 413961-416393	Sequence	SLY_0484 exp7 putative cation-transporting ATPase exp7 (Protein is coded in complementary strand; from 416393 to 413961)