Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 437467
End position: 437496
Length: 30

DNA sequence
>NC_021236, from 437467 to 437496 (30 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 TTGTTTAGTTTTGTTTTGTTTAGTTTTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 437024-437584	Sequence	SLY_0505 - Hypothetical Protein (Protein is coded in complementary strand; from 437584 to 437024)