Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 452335
End position: 452359
Length: 25

DNA sequence
>NC_021236, from 452335 to 452359 (25 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 GTTTAGTTTTGTTTCTTTTAGTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 450734-452365	Sequence	SLY_0520 glnS Glutaminyl-tRNA synthetase (Protein is coded in complementary strand; from 452365 to 450734)