Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 453487
End position: 453510
Length: 24

DNA sequence
>NC_021236, from 453487 to 453510 (24 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 AAAAGACAAAGAAAAAGAAAAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 453175-453735	Sequence	SLY_0523 - Hypothetical Protein (Protein is coded in complementary strand; from 453735 to 453175)