Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 521351
End position: 521380
Length: 30

DNA sequence
>NC_021236, from 521351 to 521380 (30 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 AATTTTTTTGATTTTATTTGGTTTTTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 521259-522224	Sequence	SLY_0602 tra5 Putative transposase tra5 for insertion sequence element IS150 (Protein is coded in complementary strand; from 522224 to 521259)