Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 535537
End position: 535599
Length: 63

DNA sequence
>NC_021236, from 535537 to 535599 (63 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 GTAGTTCTTCTTGTTGTTTAAATAACTCTTCTTGTTGTTTAAGTAACCCTTCGTGTTGTTTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 534564-535757	Sequence	SLY_0614 ftsH Cell division protein ftsH-like protein (Protein is coded in complementary strand; from 535757 to 534564)