Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 536729
End position: 536753
Length: 25

DNA sequence
>NC_021236, from 536729 to 536753 (25 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 TTTTTTATTTGTTTTTTTCTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 536448-536771	Sequence	SLY_0616 - Hypothetical Protein (Protein is coded in complementary strand; from 536771 to 536448)