Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 555648
End position: 555677
Length: 30

DNA sequence
>NC_021236, from 555648 to 555677 (30 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 TTTATAGAAATTAATATAAATTTTTAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 555370-555675	Sequence	SLY_0647 - hypothetical protein