Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 559674
End position: 559698
Length: 25

DNA sequence
>NC_021236, from 559674 to 559698 (25 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 AAAAAAAACAATAAAAAAACAAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 559546-559716	Sequence	SLY_0651 - Hypothetical Protein