Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 58170
End position: 58193
Length: 24

DNA sequence
>NC_021236, from 58170 to 58193 (24 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 AAAAAGAAAAGGAAAAATAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 57880-58170	Sequence	SLY_0060 hupB Hypothetical Protein hupB