Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 662977
End position: 663000
Length: 24

DNA sequence
>NC_021236, from 662977 to 663000 (24 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 TCTTGTTGTTGTTCTAGTTTTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 662689-663486	Sequence	SLY_0769 yibP Hypothetical Protein yibP (Protein is coded in complementary strand; from 663486 to 662689)