Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 667307
End position: 667331
Length: 25

DNA sequence
>NC_021236, from 667307 to 667331 (25 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 TTTTTTATTTGTTTTTTTCTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 667029-667349	Sequence	SLY_0774 - Hypothetical Protein (Protein is coded in complementary strand; from 667349 to 667029)