Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 751824
End position: 751853
Length: 30

DNA sequence
>NC_021236, from 751824 to 751853 (30 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 AAAAAAATAAAAAATAATAGAAATAAATTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 751555-754461	Sequence	SLY_0874 - hypothetical protein