Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 774994
End position: 775020
Length: 27

DNA sequence
>NC_021236, from 774994 to 775020 (27 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 TATAGGAATTATAAGAATTATAGGAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 774750-776498	Sequence	SLY_0900 srmB putative ATP-dependent RNA helicase srmB (Protein is coded in complementary strand; from 776498 to 774750)