Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 788041
End position: 788070
Length: 30

DNA sequence
>NC_021236, from 788041 to 788070 (30 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 AAAAAACTTTCAAAATCTTTAAAAATGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 787069-788514	Sequence	SLY_0913 norM Na+-Driven Multidrug Efflux Pump