Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 804935
End position: 804964
Length: 30

DNA sequence
>NC_021236, from 804935 to 804964 (30 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 ATATTTATTAATTTTTATTTATTTTCATTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 804963-805808	Sequence	SLY_0928 - hypothetical protein (Protein is coded in complementary strand; from 805808 to 804963)