Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 832537
End position: 832561
Length: 25

DNA sequence
>NC_021236, from 832537 to 832561 (25 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 AAAAAAGAAAAAAACAAATAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 832521-832844	Sequence	SLY_0971 - Hypothetical Protein