Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 886755
End position: 886794
Length: 40

DNA sequence
>NC_021236, from 886755 to 886794 (40 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 AAACAAAAAAATAAAAAAACCAAAAAACAAAGAAACCAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 886702-886836	Sequence	SLY_1035 - Hypothetical Protein