Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 899492
End position: 899518
Length: 27

DNA sequence
>NC_021236, from 899492 to 899518 (27 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 TCTTTTAATTCTTTTAATTCATTTAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 897530-899983	Sequence	SLY_1059 rock2 Rho-associated protein kinase 2 (Protein is coded in complementary strand; from 899983 to 897530)