Sequence retrieval

Genome: Strawberry lethal yellows phytoplasma (CPA) str. NZSb11
Start position: 948357
End position: 948381
Length: 25

DNA sequence
>NC_021236, from 948357 to 948381 (25 bp); Strawberry lethal yellows phytoplasma (CPA) str. NZSb11 TTTTTTTATTTCTTTCTTTTTGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 948350-948460	Sequence	SLY_1111 - Hypothetical Protein (Protein is coded in complementary strand; from 948460 to 948350)