Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 1063890
End position: 1063913
Length: 24

DNA sequence
>NC_021282, from 1063890 to 1063913 (24 bp); Mycobacterium abscessus subsp. bolletii 50594 CGTTGGCCTTGGCGTTGAAGTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1063244-1064170	Sequence	MASS_1019 - hypothetical protein (Protein is coded in complementary strand; from 1064170 to 1063244)