Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 1096079
End position: 1096102
Length: 24

DNA sequence
>NC_021282, from 1096079 to 1096102 (24 bp); Mycobacterium abscessus subsp. bolletii 50594 CAGCAGCAGCCGCAGCAGCAGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1095498-1096523	Sequence	MASS_1053 - 34 kDa antigenic protein