Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 1165887
End position: 1165910
Length: 24

DNA sequence
>NC_021282, from 1165887 to 1165910 (24 bp); Mycobacterium abscessus subsp. bolletii 50594 TCGGCGTCGGCGTCGGAGTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1165812-1167065	Sequence	MASS_1121 - aminodeoxychorismate synthase component I (Protein is coded in complementary strand; from 1167065 to 1165812)