Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 1180352
End position: 1180375
Length: 24

DNA sequence
>NC_021282, from 1180352 to 1180375 (24 bp); Mycobacterium abscessus subsp. bolletii 50594 ATGACCAGGACCAGGACCATGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1179977-1180378	Sequence	MASS_1132 - membrane protein MmpS (Protein is coded in complementary strand; from 1180378 to 1179977)